Popular tips

What is pcDNA3 plasmid?

What is pcDNA3 plasmid?

pcDNA3. Description: Mammalian expression vector with CMV promoter, BGH polyA signal, T7, SP6; amp resistance (neomycin for mammalian selection); restriction enzyme cloning. Synonyms: pcDNA-3.

What is pcDNA3?

Introduction on pcDNA3. 1(+)/pcDNA3. 1 (-) Vectors. Cloning vectors are mainly used to clone and amplify DNA fragments, so that foreign genes can be replicated and amplified in host cells. Expression vectors are used to efficiently express foreign genes in host cells.

What is pcDNA vector?

Description. This pcDNA™3.1(+) vector is designed for high-level, constitutive expression in a variety of mammalian cell lines. It contains a Geneticin® selectable marker and a forward-orientation multiple cloning site.

What is pcDNA used for?

pcDNA3. 0 is a mammalian expression vector of 5.4 kb which are specially designed for high-level stable and transient expression in mammalian hosts. pcDNA is available with the multiple cloning sites in the forward (+) and reverse (–) orientations to facilitate good cloning.

How does plasmid cloning work?

In a typical cloning experiment, a target gene is inserted into a circular piece of DNA called a plasmid. The plasmid is introduced into bacteria via a process called transformation, and bacteria carrying the plasmid are selected using antibiotics.

What is the difference between pcDNA3 and pcDNA3 1?

pcDNA3 is no longer available from Thermo Fisher Scientific but has been directly replaced by pcDNA3. 1, which was derived from pcDNA3. The center of the multiple cloning site (MCS) within the original pcDNA3 vector contained homology to a hairpin mRNA structure and involved the Eag I, Not I, and both BstXI sequences.

Why is GFP so important?

Biologists use GFP to study cells in embryos and fetuses during developmental processes. Biologists use GFP as a marker protein. GFP can attach to and mark another protein with fluorescence, enabling scientists to see the presence of the particular protein in an organic structure.

What is the difference between a cloning vector and an expression vector?

In general, cloning vectors are plasmids that are used primarily to propagate DNA. An expression vector is a specialized type of cloning vector. Expression vectors are designed to allow transcription of the cloned gene and translation into protein.

What is a CMV promoter?

The CMV promoter is a commonly used promoter for the production of high level recombinant protein in mammalian cells17. However, the expression level of the transgene driven by CMV promoter decreases with extended culture times because of transcriptional silencing, which is associated with DNA methylation18, 19.

Which is the primer for sequencing out GFP based constructs?

The primer for sequencing out the 5′ end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5′- GTCTTGTAGTTGCCGTCGTC -3′

How long can DNA be stored in a plasmid?

Storage DNA can be stored at 4℃ (short term) or -20℃ (long term). Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

Can a cloning grade DNA be used in PCR?

This material is available to academics and nonprofits only. EGFP from discontinued clonetech vector. Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections. Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).